View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_199 (Length: 234)
Name: NF6874A_low_199
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_199 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 32892062 - 32891866
Alignment:
| Q |
17 |
acatcaaagaacttggaatacaatgaagaacatcaaattgctgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892062 |
acatcaaagaacttggaatacaatgaagaacatcaaattgttgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
32891963 |
T |
|
| Q |
117 |
gttttctggtcatgttagaaaattctagcggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgttgggtggggggat |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891962 |
gttttctggtcatgttagaaaattcttgcggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgttgggtggggggat |
32891866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University