View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_23 (Length: 392)
Name: NF6874A_low_23
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 13 - 387
Target Start/End: Original strand, 42484706 - 42485080
Alignment:
| Q |
13 |
aatatgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccacctcgcctgtggcttcgtcgacggtagtgtccgact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42484706 |
aatatgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccaccttgcctgtggcttcgtcgacggtagtgtccgact |
42484805 |
T |
|
| Q |
113 |
cttcgatctccacaccggcgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcgggaattttaattgga |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
42484806 |
cttcgatctccacaccggtgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcaggaattgtaattgga |
42484905 |
T |
|
| Q |
213 |
agctctactctcgccttcgcaagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaa |
312 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484906 |
agctctactctcgccttcgcgagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaa |
42485005 |
T |
|
| Q |
313 |
ttattggtgatgttgttaataacggagtattagtagaatttgccggctttagtcgatggtgggttggtttatatg |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
42485006 |
ttattggtgatgttgttaataacggagtattagtagaatttgccggctctagtcgttggtgggttggtttatatg |
42485080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University