View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6874A_low_242 (Length: 227)

Name: NF6874A_low_242
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6874A_low_242
NF6874A_low_242
[»] chr8 (1 HSPs)
chr8 (17-55)||(37918344-37918382)


Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 37918382 - 37918344
Alignment:
17 accaaaccaataccatcaaatctaataaccttaattcct 55  Q
    |||||||||| ||||||||||||||||||||||||||||    
37918382 accaaaccaaaaccatcaaatctaataaccttaattcct 37918344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University