View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_258 (Length: 218)
Name: NF6874A_low_258
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_258 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 48399655 - 48399477
Alignment:
| Q |
20 |
gtttcgtgtttgaaacgacnnnnnnnatgacataacatataagactttaaaatatcattagttaaataatttaaccataatttcaaataaaagatcaaaa |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48399655 |
gtttcgtgtttgaaacgactttttttatgacataacatataagactttaaaatatcattagttaaataatttaaccataatttcaaataaaagatcaaaa |
48399556 |
T |
|
| Q |
120 |
tggtaaaacttgaggttacaagtcgattccatctaggcaaaataagttgaggtaaaaactcaaatttgattgtttggag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48399555 |
tggtaaaacttgaggttacaagtcgattccatctaggcaaaataagttgaggtaaaaactcaaatttgattgcttggag |
48399477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 94
Target Start/End: Original strand, 42111604 - 42111640
Alignment:
| Q |
58 |
ataagactttaaaatatcattagttaaataatttaac |
94 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42111604 |
ataagactttaaaatatcattagtttaataatttaac |
42111640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University