View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_259 (Length: 218)
Name: NF6874A_low_259
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_259 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 5 - 140
Target Start/End: Original strand, 31133894 - 31134029
Alignment:
| Q |
5 |
caaaacttggcttattccacaccactgtgattttagaaaacaaaaacatttgctgaatgcctctcctcccagttccatccacccccaaaaccctaaattc |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31133894 |
caaaagttggcttattccacaccactgtgagtttagaaaacaaaaacatttgctgaatgcctctcctctcagttccatccaccaccaaaaccctaaattc |
31133993 |
T |
 |
| Q |
105 |
tccatcccctttctatcaccaccatgccactttctt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31133994 |
tccatcccctttctatcaccaccatgccactttctt |
31134029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University