View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_270 (Length: 211)
Name: NF6874A_low_270
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_270 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 48 - 193
Target Start/End: Complemental strand, 13889349 - 13889204
Alignment:
| Q |
48 |
gggacatctttaaagtgttcggattgtgtgacctcgtggaattacctatttaccgtcaatgaataataataatttttgtgataaggttgatgatttgtga |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13889349 |
gggacatctttaaagtgttcggattgtgtgatctcgtggagttacctattcaccgtcaatgaataataataatttttgtgataaggttgaagatttgtga |
13889250 |
T |
 |
| Q |
148 |
caattatttgttgaagttgatttataaaatgtcggttttcattcat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13889249 |
caattatttgttgaagttgatttataaaatgtcggttttcattcat |
13889204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University