View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_276 (Length: 208)
Name: NF6874A_low_276
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_276 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 28668086 - 28668252
Alignment:
| Q |
22 |
gtgtctgatacgagaatagagcgtcctgaacagcaagcttccccttatattattgctctcgttgaaactgattttttccagaccgtagagcacctagcag |
121 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||||||| |||| ||||||||||| ||||||||||||||||||| ||||||||||||||| | ||| |
|
|
| T |
28668086 |
gtgtctgatacgacaatagagcatcctgaacaacaagcttcaccttctattattgctcccgttgaaactgattttttctagaccgtagagcacccaacag |
28668185 |
T |
|
| Q |
122 |
aaacacctcttgatggcggtaacaactcttttcatttcgcactcgaaaatg-tttatgatgaaattg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
28668186 |
aaacacctcttgatggcggtaacaactcttttcatttcgcactcgaaaatgttttctgatgaaattg |
28668252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University