View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6874A_low_276 (Length: 208)

Name: NF6874A_low_276
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6874A_low_276
NF6874A_low_276
[»] chr5 (1 HSPs)
chr5 (22-187)||(28668086-28668252)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 28668086 - 28668252
Alignment:
22 gtgtctgatacgagaatagagcgtcctgaacagcaagcttccccttatattattgctctcgttgaaactgattttttccagaccgtagagcacctagcag 121  Q
    ||||||||||||| |||||||| ||||||||| |||||||| |||| ||||||||||| ||||||||||||||||||| ||||||||||||||| | |||    
28668086 gtgtctgatacgacaatagagcatcctgaacaacaagcttcaccttctattattgctcccgttgaaactgattttttctagaccgtagagcacccaacag 28668185  T
122 aaacacctcttgatggcggtaacaactcttttcatttcgcactcgaaaatg-tttatgatgaaattg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||    
28668186 aaacacctcttgatggcggtaacaactcttttcatttcgcactcgaaaatgttttctgatgaaattg 28668252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University