View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6874A_low_282 (Length: 206)

Name: NF6874A_low_282
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6874A_low_282
NF6874A_low_282
[»] chr8 (1 HSPs)
chr8 (29-173)||(37969581-37969725)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 29 - 173
Target Start/End: Complemental strand, 37969725 - 37969581
Alignment:
29 acaagattttcgaatccttcccaagattgttaaccttaaatttacaaacaacatgagatgtcataacccatgttttgagtcccgaagccgtcatcctgac 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
37969725 acaagattttcgaatccttcccaagattgttaaccttaaatttacaaacaacatgagatgtcataacccatgttttgagtcccgaagccgtcatcctcac 37969626  T
129 accaagattcatatccaattcaaagttcacgggcttctttgccat 173  Q
    |||||||||||||||||||||||||||||||||| ||||||||||    
37969625 accaagattcatatccaattcaaagttcacgggcatctttgccat 37969581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University