View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_285 (Length: 205)
Name: NF6874A_low_285
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_285 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 9 - 201
Target Start/End: Complemental strand, 13139973 - 13139781
Alignment:
| Q |
9 |
gctggtgtaccacattctcagcattaccaaacttaatcatgagattagaaccacgacctttcaacgacttcctcaaatctcgaacagcaaacacaacgag |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13139973 |
gctggtgtatcacattctcagcattaccaaacttaatcatgagattagaaccacgacctttcaacgacttcctcaaatctcgaacagcgaacacaacgag |
13139874 |
T |
|
| Q |
109 |
ttccatcatttcatcggaaaaccctgcggagcaagcaaaacagcatcaatagagtcagtttctaacatttcaattcgatgagtgattatgaag |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13139873 |
ttccagcatttcatcggaaaaccctgcggagcaagcaaaacagcatcaatagagtcagtttctaacatttcaattcgatgagtgatgatgaag |
13139781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University