View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_286 (Length: 205)
Name: NF6874A_low_286
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_286 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 114 - 194
Target Start/End: Original strand, 9303631 - 9303712
Alignment:
| Q |
114 |
tgatggtatcagacaaggtttggaattagg-ttgatgcaaaatttggcagctttccttgtgttttttcttgatgtccatctc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9303631 |
tgatggtatcagacaaggtttggaattagggttgatgcaaaatttggcagctttccttgtgttttttcttgatgtccttctc |
9303712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University