View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_36 (Length: 362)
Name: NF6874A_low_36
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 132 - 238
Target Start/End: Complemental strand, 24863754 - 24863648
Alignment:
| Q |
132 |
aaaactgacattgatggtgtactttgttgtagggggtggtagaaaagtgacacgagtcgaggtaacaatggacggtggagaaacatggcacgtgtgcaca |
231 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24863754 |
aaaactgacattggtggtgtactttgttatagggggtggtagaaaagtgacacgagtcgaggtaacaatggacggtggagaaacatggcacgtgtgcaca |
24863655 |
T |
|
| Q |
232 |
ttggacc |
238 |
Q |
| |
|
||||||| |
|
|
| T |
24863654 |
ttggacc |
24863648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 162 - 238
Target Start/End: Complemental strand, 32988709 - 32988633
Alignment:
| Q |
162 |
agggggtggtagaaaagtgacacgagtcgaggtaacaatggacggtggagaaacatggcacgtgtgcacattggacc |
238 |
Q |
| |
|
||||||||||||||| |||||||| || || ||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
32988709 |
agggggtggtagaaaggtgacacgtgttgaagtaacaatggacggtggtgaaacatggcaagtatgcacattggacc |
32988633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University