View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_high_19 (Length: 299)
Name: NF6875A_high_19
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_high_19 |
 |  |
|
| [»] scaffold0212 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0212 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 12232 - 12497
Alignment:
| Q |
1 |
atctatcaaagtggtatcggagattttttcttaatggaaacttgtataggcccctatggctctcctaaaacccttcataagggatatggctataatgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12232 |
atctatcaaagtggtatcggagattttttcttaatggaaacttgtataggcccctatggctctcctaaaacccttcataagggatatggctataatgaga |
12331 |
T |
 |
| Q |
101 |
atatcttgctttccgcacccgctagtgcacatacactttcgtttacttgggctcgtgaggtggtgggaaatggcctgatctatgcttatgctcttgtcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12332 |
atatcttgctttccgcacccgctagtgcacatacactttcgtttacttgggctcgtgaggtggtgggaaatggcctgatctatgcttatgctcttgtcta |
12431 |
T |
 |
| Q |
201 |
aggagtccgcagactcttattagactgcttgtgcctatgtctcgcgaaatccatgatgtccatctc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12432 |
aggagtccgcagactcttattagactgcttgtgcctatgtctcgcgaaatccatgatgttcatctc |
12497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 259
Target Start/End: Original strand, 21805420 - 21805468
Alignment:
| Q |
211 |
agactcttattagactgcttgtgcctatgtctcgcgaaatccatgatgt |
259 |
Q |
| |
|
|||||||||||||| || |||||||||||||| ||||||||||| |||| |
|
|
| T |
21805420 |
agactcttattagaatgtttgtgcctatgtcttgcgaaatccataatgt |
21805468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University