View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_high_22 (Length: 287)
Name: NF6875A_high_22
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 23 - 274
Target Start/End: Complemental strand, 41963442 - 41963182
Alignment:
| Q |
23 |
aaagaagtttaatttcatggatgattgtcctcaaaaattaaaaatcatccctgatcactttcaaattccaacttcaagtatagaatct---------tct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41963442 |
aaagaagtttaatttcatggatgattgtcctcaaaaattaaaaatcatccctgatcactttcaaattccaacttcaagtatagaatctatagaatcttct |
41963343 |
T |
|
| Q |
114 |
cagagcagacaattatctacttctgaagaacctggaattgatcaatctttaaggtattgtttacgggtcaaaatagcaataataaaaaagttattcggag |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41963342 |
cagagcagacaattatctacttccgaagaacctggaattgatcaatctttaaggtattgtttacgggtcaaaatagcaataataaaaaagttattcggag |
41963243 |
T |
|
| Q |
214 |
actttgagtttatttgaagtaagttactcaatttagcttagtttaggtcctccccccatct |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41963242 |
actttgagtttatttgaagtaagttactcaatttagcttagtttaggtcctccccccatct |
41963182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University