View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_high_28 (Length: 251)
Name: NF6875A_high_28
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_high_28 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0212 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 21 - 251
Target Start/End: Original strand, 11996 - 12226
Alignment:
| Q |
21 |
atcaaaaccgactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11996 |
atcaaaaccgactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagc |
12095 |
T |
|
| Q |
121 |
tgcttcgagcattggtatgaaacccggaatattttatttgaaatcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaaga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12096 |
tgcttcgagcattggtatgaaacccggaatattttatttgaaatcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaaga |
12195 |
T |
|
| Q |
221 |
agcttgtgcatctttctattttatgtttgtt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12196 |
agcttgtgcatctttctattttatgtttgtt |
12226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 64 - 243
Target Start/End: Original strand, 16576868 - 16577047
Alignment:
| Q |
64 |
ttattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagctgcttcgagcattggtatgaaacccggaatattttatttgaaa |
163 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| || ||||||||||| ||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
16576868 |
ttattaaggttatcagataagctccaggtttagttgtagtttcgtggatagaggagttgcttcgagtattggtatgaaacccgaaatattttatttgaaa |
16576967 |
T |
|
| Q |
164 |
tcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaagaagcttgtgcatctttctatttta |
243 |
Q |
| |
|
||| ||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16576968 |
tcgtgatgagttaaagaaatcaacccgaaattcagtccatgataggatagggaaagaagcttgtgcatctttctatttta |
16577047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 9628897 - 9628815
Alignment:
| Q |
21 |
atcaaaaccgactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagt |
103 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9628897 |
atcaaaaccgactgcctagatatagagcagattttgtccatgattattaaggtaactagataagctccaggtttagttgtagt |
9628815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University