View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_106 (Length: 294)
Name: NF6875A_low_106
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_106 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 12 - 288
Target Start/End: Complemental strand, 39920023 - 39919749
Alignment:
| Q |
12 |
atgaatgcggaggtttatacagagttttgtgagatttggcatgggcttagtgtgtggtgtgaagtttcaaatctgcggcaactnnnnnnntcgcgtcgca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
39920023 |
atgaatgcggaggtttatacagagttttgtgagatttggcatgggcttagtgtgtggtgtgaagtttcaaatccgcggcaactaaaaaaatcgcgtcgca |
39919924 |
T |
|
| Q |
112 |
atgcactttttggtcatggaacaagaagcagagaatttgcttcactccagacatgcattaactccttcccaccactaaccaaacagacacttaatgtggc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39919923 |
atgcactttttggtcatggaacaagaagcagagaatttgcttcactccagacatgcgttaactccttcccaccactaaccaaacagacacttaatgtggc |
39919824 |
T |
|
| Q |
212 |
caacttgaggagttttccgaaggtagaacctaactctcaaaatccatcgattattattattcagtttagcgagattt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39919823 |
caacttgaggagttttccgaaggtagaacctaa--ctcaaaatccatcgattattattattaagtttagcgagattt |
39919749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University