View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_115 (Length: 289)
Name: NF6875A_low_115
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_115 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 40659958 - 40660066
Alignment:
| Q |
1 |
tcaacaaacaacaa-gaagcacatcatggaacatttggcttgcacactactatcaagctgatacccaattcctacatgccctgtaaaccataggctccaa |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40659958 |
tcaacaaacaacaaagaagcacatcatggaacatttggcttgcacactactatcaagctgatacccaattcctacatgccctgtaaaccataggctccaa |
40660057 |
T |
 |
| Q |
100 |
acaggacaa |
108 |
Q |
| |
|
||||||||| |
|
|
| T |
40660058 |
acaggacaa |
40660066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University