View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_12 (Length: 444)
Name: NF6875A_low_12
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 3e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 161 - 298
Target Start/End: Complemental strand, 2950693 - 2950556
Alignment:
| Q |
161 |
aaatagagcttgaagggaagataacacgtggaaataattgggtaattaagattaagatattggattatggagaaaagggaataaaagatacatatatttg |
260 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2950693 |
aaatagaccttgaagggaagataacacgtggaaataattgggtaattaagattaagatattggattatggagaaaagggaataaaagatacatatatttg |
2950594 |
T |
|
| Q |
261 |
aattgtttgagnnnnnnnnggaaggaaatgaatatatt |
298 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
2950593 |
aattgtttgagaaaaaaaaggaaggaaatgaatatatt |
2950556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University