View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_133 (Length: 279)
Name: NF6875A_low_133
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_133 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 55104 - 54890
Alignment:
| Q |
7 |
aatattccatagcattccacttataccgtgcatatatatgtatattaattaattagtctttttattataattataaagctctagctggttataaaaagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55104 |
aatattccatagcattccacttataccgtgcatatatatgtatattaattaattagtctttttattataattataaagctctagctggttataaaaagaa |
55005 |
T |
|
| Q |
107 |
aaattaatgtatgtaaggtctcttttgtgggcagacatattctacaaagaaagaattgtaataagaaaatgtcataattaggggtatcttacttttgaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55004 |
aaattaatgtatgtaaggtctcttttgtgggcagacatattctacaaagaaagaattgtaataagaaaatgtcataattaggggtatcttacttttgaag |
54905 |
T |
|
| Q |
207 |
cttagtgccttaatc |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54904 |
cttagtgccttaatc |
54890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 236 - 267
Target Start/End: Complemental strand, 54879 - 54848
Alignment:
| Q |
236 |
ctttgatgtttgatcgtatcctaattaagtat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54879 |
ctttgatgtttgatcgtatcctaattaagtat |
54848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University