View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_134 (Length: 279)
Name: NF6875A_low_134
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_134 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 3 - 270
Target Start/End: Original strand, 55374567 - 55374834
Alignment:
| Q |
3 |
ggaagttaattagtgtttacaatagaaagctcctcagaaatctatatatttggacggcttttaagtaggacaagcacgtcttgtgaaattgtcatgcttg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55374567 |
ggaagttaattagtgtttacaatagaaagctcctcagaaatctatatatttggacggcttttaagtaggacaagcacgtcttgtgaaattctcatgcttg |
55374666 |
T |
|
| Q |
103 |
gattcaatataataacttatatttaagtcaaaagctaagtaaaattagaatttagttctaaatatttaacaaatttgtcaattatgctagaagttacaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55374667 |
gattcaatataataacttatatttaagtcaaaagctaagtaaaattagaatttagttttaaatatttaactaatttgtcaattatgctagaagttacaat |
55374766 |
T |
|
| Q |
203 |
ggagcctagtttagattaactttaattcgtttatgaaaacttatcaacttacataagtatatattgtt |
270 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55374767 |
ggagcctaatttagattaactttaattcgtttatgaaaacttatcaacttacataagtatatattgtt |
55374834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University