View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_139 (Length: 274)
Name: NF6875A_low_139
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_139 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 27 - 274
Target Start/End: Complemental strand, 5012345 - 5012098
Alignment:
| Q |
27 |
atccttttcatctgcaaaattacttccaggagttacgttccctccttgttgatgtgttgcatctaacacatgcctcgcggggtattgagaaggtgttcca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012345 |
atccttttcatctgcaaaattacttccaggagttacgttccctccttgttgatgtgttgcatctaacacatgcctcgcggggtattgagaaggtgttcca |
5012246 |
T |
|
| Q |
127 |
gcagtattcccaatatatctaacataacgaactggtatttctttgtgatctacctttttgaggataactttttcaaagatgggtgatttactctcaaact |
226 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012245 |
gcagtattcccaatatatctagcataacgaactggtatttctttgtgatctacctttttgaggataactttttcaaagatgggtgatttactctcaaact |
5012146 |
T |
|
| Q |
227 |
gaggcttaatcggtgcaggttttttgccgtgagctagcagttgagaca |
274 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5012145 |
gagtcttaatcggtgcaggttttttgccgtgagctagcggttgagaca |
5012098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University