View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_153 (Length: 268)
Name: NF6875A_low_153
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_153 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 55 - 248
Target Start/End: Complemental strand, 29776475 - 29776282
Alignment:
| Q |
55 |
aatgttaatgcatataatatgtgaaggaaatgattcattgatttcttctcttgtttgcagattggcttggtgttgaagaagttgttggatgagggcgtag |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29776475 |
aatgttaatgcatataatatgtgaaggaaatgattcattgatttcttctcttgtttgcagattggcttggtgttgaagaagttgttcgatgagggcgtag |
29776376 |
T |
 |
| Q |
155 |
tgaagcgcgaagatttgtggattacctctaaactctggtttgtatgaatgttttagctaatttatgaatgtgttagtcttgttcactgtttagt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776375 |
tgaagcgcgaagatttgtggattacctctaaactctggtttgtatgaatgttttagctaatttatgaatgtgttagtcttgttcactgtttagt |
29776282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 197
Target Start/End: Complemental strand, 29786751 - 29786681
Alignment:
| Q |
127 |
ttgaagaagttgttggatgagggcgtagtgaagcgcgaagatttgtggattacctctaaactctggtttgt |
197 |
Q |
| |
|
|||||||| ||||| | || ||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29786751 |
ttgaagaaattgtttgccgaaggcgtagtgaaacgtgaagatttgtggattacctctaaactctggtttgt |
29786681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University