View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_155 (Length: 266)
Name: NF6875A_low_155
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_155 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 40688458 - 40688199
Alignment:
| Q |
1 |
gaaaatgtaggttccaatgagaggcattcataaaggatctaacatattgaatgatgggagcataaggatgaatgtatataggattattccttacactcag |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40688458 |
gaaaatgtaggttccaattagaggcattcataaaggatctaacatattgaatgatgggagcataaggatgagtgtatataggattattccttacactcag |
40688359 |
T |
 |
| Q |
101 |
attctatcagattggagatagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcaaaaccaaactatgagca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40688358 |
attctatcagattggagatagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcagaaccaaactatgagca |
40688259 |
T |
 |
| Q |
201 |
aaattgcatgtaattccacatcgatattataagtatagtcaataacctaatattattgga |
260 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40688258 |
aaattgcatgtaattcaacatcgatattataagtatagtcaataacctaatattattgga |
40688199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University