View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_178 (Length: 251)
Name: NF6875A_low_178
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_178 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 41963040 - 41962813
Alignment:
| Q |
1 |
aggttttcttatatcctacctatacaaacttttattctgtaggttgagctaacagctgcagaagtagagtcacttcgatcggagcttgctgatttagagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41963040 |
aggttttcttatatcctacctatacaaacttttattctgtaggttgagctaacagctgcagaagtagagtcacttcgatcggagcttgctgatttagagg |
41962941 |
T |
|
| Q |
101 |
agagggaagctcacttgaaagctcagtgagtgatccacaattttgaactatttagggattttgtgtcataatctaatttaagcgttcattgattaacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41962940 |
agagggaagctcacttgaaagctcagtgagtgatccccaattttgaactatttagggatttggtgtcataatctaatttaagcgttcattgattaacttt |
41962841 |
T |
|
| Q |
201 |
tttcttttaagttactatcattcttttg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41962840 |
tttcttttaagttactatcattcttttg |
41962813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 33 - 137
Target Start/End: Original strand, 2184620 - 2184724
Alignment:
| Q |
33 |
tattctgtaggttgagctaacagctgcagaagtagagtcacttcgatcggagcttgctgatttagaggagagggaagctcacttgaaagctcagtgagtg |
132 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| |||||||| || |||| |||||| ||||||| ||| ||||| || ||||||||||||||| |
|
|
| T |
2184620 |
tattttgtaggttgaactaacagctgcagaagtagagtctcttcgatcagaacttgttgatttggaggagaaggaggctcagttaaaagctcagtgagtg |
2184719 |
T |
|
| Q |
133 |
atcca |
137 |
Q |
| |
|
||||| |
|
|
| T |
2184720 |
atcca |
2184724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University