View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_191 (Length: 250)
Name: NF6875A_low_191
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_191 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 3776156 - 3775916
Alignment:
| Q |
10 |
tgagatggacatcacggcaaaagccaaggggcactgggatagtacggaacttgcggttggaagctttgacaatttggcataacttgttcaacagaactgc |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3776156 |
tgagatggactccacggcaaaagccaaggggcactgggatagtacggaacttgtggttggaagctttgacaatttggcataacttgttcaacagaactgc |
3776057 |
T |
|
| Q |
110 |
tggcagctgcatcttctgtcagcgttgttgatgtgtcagaagatttgatggaatgttcatcactcttttcttccccaacatagggtacatgaatctgcag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3776056 |
tggcagctgcatcttctgtcagcgttgttgatgtgtcagaagatttgatggaatgttcatcactcttttcttccccaacatagggtacatgaatccgcag |
3775957 |
T |
|
| Q |
210 |
tgcttccggtctaatgaatccgtttttcggggaaatattaa |
250 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
3775956 |
tgcttccggtctaatgaatccatttttctgggaaatattaa |
3775916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University