View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_198 (Length: 249)
Name: NF6875A_low_198
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_198 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 30507978 - 30507741
Alignment:
| Q |
1 |
tcagttactttgtttgagggattgggctccacagttgtatgcagggttaccttgacgcaacnnnnnnncaaaa---cattatttcataactgcttagcat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
30507978 |
tcagttactttgtttgagggattgggctccacagttgtatgcagggttaccttgacgtaacaaaaaaaaaaaaaatcattatttcataactgcttagcat |
30507879 |
T |
|
| Q |
98 |
agggtatggaaaaaatgcataattccattttctgaaagnnnnnnnnn-tttgctaaatcttttggtgttgtgacaggtgattaaagattttgctagtgga |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30507878 |
agggtatgaaaaaaatgcataattccattttctgaaagaaaaaaaaaatttgctaaatcttttggtgttgtgacaggtgattaaagattttgctagtgga |
30507779 |
T |
|
| Q |
197 |
gaaataaagcaagcttctagcttgtttgattgtgatgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30507778 |
gaaataaagcaagcttctagcttgtttgattgtgatgt |
30507741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University