View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_207 (Length: 247)
Name: NF6875A_low_207
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_207 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 12905684 - 12905888
Alignment:
| Q |
19 |
aaaagagtaaattgtccatttatcattgattttagagtattgaaagcctttaaagctaacacccatcatccaaatgctccatttttcattgaagttatct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12905684 |
aaaagagtaaattgtccatttatcattgattttagagtattgaaagcctttaaagttaacacccatcatccaaatgctccatttttcattgaagttatct |
12905783 |
T |
|
| Q |
119 |
ggcatccaccaattctaaattggataaactgtaacactgatgcacaacattaggggcccctaattaagcaacatgtgcaggtatattaagaaacaaacat |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12905784 |
ggcatccaccaattctaaattggttaaactgtaacactgatgcacaacattaggggcccctaattaagcaacatgtgcaggtatattaagaaacaaacat |
12905883 |
T |
|
| Q |
219 |
ggtga |
223 |
Q |
| |
|
||||| |
|
|
| T |
12905884 |
ggtga |
12905888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University