View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_211 (Length: 246)
Name: NF6875A_low_211
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_211 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 154 - 246
Target Start/End: Original strand, 26287204 - 26287298
Alignment:
| Q |
154 |
gagtgtcgtgcatggggc--tctcacacccttgattgcgttttttgtaatcattattgatggggattgcttgtatcacaaggaggtggttcttgg |
246 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26287204 |
gagtgtcgtgcatggggcgctctcacacccttgattgcattttttgtaaccattattgatggggactgcttgtatcacaaggaggtggttcttgg |
26287298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 26287509 - 26287639
Alignment:
| Q |
7 |
tttggagggttttggtgtgagtatcgggggatctgtgtttgagatttgtttccgtggctattcacagtggagtttgaattttttgactcatgttcggttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||| | ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
26287509 |
tttggagggttttggtgtgagtatcgggggatatgtgtttgagatttg----cgtt---------aatggagtttgaagtttttgactcatgtttggttt |
26287595 |
T |
|
| Q |
107 |
ctgctatcatgtgggagttcaactttgatttagtgttggcttta |
150 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26287596 |
ttgctgttgtgtgggagttcaactttgatttagtgttggcttta |
26287639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University