View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_217 (Length: 244)
Name: NF6875A_low_217
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_217 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 18050625 - 18050390
Alignment:
| Q |
1 |
tcaaagtacaggtccccctcggcaagatcccccttaatggtagacttgataaaggtcaaatcatgaggccagggaaacacaaaatttttaggctagccca |
100 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18050625 |
tcaaagtacaagtctccctctgcaagatcccccctaatggtagacttgataaaggtcaaatcatgaggccagggaaacacaaaatttttaggctagccca |
18050526 |
T |
 |
| Q |
101 |
aaatgtatgcacagatggaaacaaagtaaagtaactccaccactatcaattgtctatcttagagggtgacaagaccattcttgagtgaccctcgatcccg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18050525 |
aaatgtatgcatagatggaaacaaagtaaagtaactccacaactatcaattgtctatcttagagggtgacaagaccattcttgagtgaccctcgatcccg |
18050426 |
T |
 |
| Q |
201 |
tgggaagggtaagttggcccttcaagatgtccatct |
236 |
Q |
| |
|
| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
18050425 |
cgagaagggtaagttggcccttcaggatggccatct |
18050390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University