View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_222 (Length: 243)
Name: NF6875A_low_222
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_222 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 38 - 243
Target Start/End: Original strand, 15935689 - 15935894
Alignment:
| Q |
38 |
agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935689 |
agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct |
15935788 |
T |
|
| Q |
138 |
tcgttgaggttagaaagctttttgccgaggagctcgtataattcatcgtcggggagacgagatatcacaaatttggggaggtaaggggccttgtttgcca |
237 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
15935789 |
tcggggaggttagaaagctttttgccgaggagctcgtataattcatcgtcggagagacgagatattacaaatttggggaggtaagagaccttgtttgcca |
15935888 |
T |
|
| Q |
238 |
atctga |
243 |
Q |
| |
|
|||||| |
|
|
| T |
15935889 |
atctga |
15935894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University