View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6875A_low_234 (Length: 238)

Name: NF6875A_low_234
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6875A_low_234
NF6875A_low_234
[»] chr4 (1 HSPs)
chr4 (53-238)||(35679142-35679327)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 53 - 238
Target Start/End: Complemental strand, 35679327 - 35679142
Alignment:
53 tctttgtgtttagcaagtggagcaattatgttggatgtgtggctgggcatttttctttgctgtggtttttaattgcggtggttcatcattaagttcatgc 152  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||    
35679327 tctttgtgtttagcaagtggagcaataatgttggatgtgtggctgggcatttttctttggtgtggtttttaattgcggcggttcatcattaagttcatgc 35679228  T
153 aattttgattgtagaggtacctaagctagtttccaggtgattgatatataatatgctgcatagcgatccaaaacttgcataattgt 238  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||    
35679227 aattttgattgtagaggtaccaaagctagtttgcaggtgattgatatataatatgctgcatagcgatccaaaatttgcataattgt 35679142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University