View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_237 (Length: 234)
Name: NF6875A_low_237
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_237 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 9538999 - 9539217
Alignment:
| Q |
7 |
ggacatcacatgcatcagcttatagttgcagattcttctcacacaagtttttcagtgatatatcaatgttgttggaacattgttcaattatttaaattat |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
9538999 |
ggacatcacatgcatcagtttatagttgcagattcttctcacacaaatttttcaatgatatatcaattttgttggaacattgttgaattatttaaattat |
9539098 |
T |
|
| Q |
107 |
gaactaagttcaaatatgattttttaaatatactannnnnnnnnaactcatgcataagattagaaactcacatttagatttccttgtgttannnnnnnca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9539099 |
gaactaagttcaaatatgattttttaaatatactatttttttttaactcatgcataagattagaaactcacatttagatttccttgtgttatttttttca |
9539198 |
T |
|
| Q |
207 |
tttcaagtgtcatattctt |
225 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
9539199 |
tttcaagtgtcattttctt |
9539217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University