View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_240 (Length: 232)
Name: NF6875A_low_240
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_240 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 4 - 232
Target Start/End: Original strand, 49007079 - 49007307
Alignment:
| Q |
4 |
cggtcatggtactcacgcttcaaccactgctgctggaagtaaagttgaggatgcatcctacttcggctatgccgctggatcagccataggtatcactaaa |
103 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007079 |
cggtcatggtactcacacttcaaccactgctgctggaagtaaagttgaggatgcatccttcttcggctatgccgctggatcagccataggtatcactaaa |
49007178 |
T |
|
| Q |
104 |
atatctcacttattgttaacttgatcaacaacgaatactggaggtttttatttataatacatatgaatccatatcaaaattaaccaaatttatatcgaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007179 |
atatctcacttattgttaacttgatcaacaacgaatactggaggtttttatttataatacatatgaatccatatcaaaattaaccaaatttatatcgaat |
49007278 |
T |
|
| Q |
204 |
aataggcatggctccacatgctcatgtat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49007279 |
aataggcatggctccacatgctcatgtat |
49007307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 131
Target Start/End: Original strand, 37067889 - 37067929
Alignment:
| Q |
91 |
aggtatcactaaaatatctcacttattgttaacttgatcaa |
131 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
37067889 |
aggtattactaaaatatctcatttattgataacttgatcaa |
37067929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University