View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_246 (Length: 232)
Name: NF6875A_low_246
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_246 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 41 - 171
Target Start/End: Original strand, 43921966 - 43922096
Alignment:
| Q |
41 |
tgttattgaaagtggaaagtagaatcgataagatactagtggtgcaattacggattctagtgcgatcgatgataataagagaggtgaaatgaataaaaaa |
140 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43921966 |
tgttattgaaagtgaaaagtagaatcgataagatactagtggtgcaattacggattctagtgcgatcgatgataataagagaggtgaaatgaataaaaaa |
43922065 |
T |
|
| Q |
141 |
ggagatagaaattgaaaccttgattttcatc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43922066 |
ggagatagaaattgaaaccttgattttcatc |
43922096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University