View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_264 (Length: 229)
Name: NF6875A_low_264
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_264 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 29408626 - 29408425
Alignment:
| Q |
15 |
gaacaatattgctcattgcaatcatatttaagccacacatcattgatgaagttgaccatcttagcgcaaatcaccatagctaacnnnnnnncttttgtag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29408626 |
gaacaatattgctcattgcaatcatatttaagccacacatcattaatgaagttgaccatcttagcgcaaatcaccatagctaactttttt-cttttgtag |
29408528 |
T |
|
| Q |
115 |
gaaatttctaaaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattccagtcctcactctatagcctgatgtc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29408527 |
gaaatttctaaaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattccagtcctcactctatagcctaatgtc |
29408428 |
T |
|
| Q |
215 |
cat |
217 |
Q |
| |
|
||| |
|
|
| T |
29408427 |
cat |
29408425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 190
Target Start/End: Original strand, 29456102 - 29456183
Alignment:
| Q |
109 |
ttgtaggaaatttctaaaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattcca |
190 |
Q |
| |
|
|||||| ||||| ||||||| || || |||||||||||||||||||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
29456102 |
ttgtagaaaattcttaaaccagattgcagacatttttggatatcttttgatgccattattgtaatctacaaagtatattcca |
29456183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 190
Target Start/End: Complemental strand, 29425770 - 29425705
Alignment:
| Q |
125 |
aaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattcca |
190 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| || ||||||| |||| ||||||| |
|
|
| T |
29425770 |
aaccatacagctgacatttttggatatcttttgaggccatcattgtaatctatgaagtatattcca |
29425705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University