View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_265 (Length: 229)
Name: NF6875A_low_265
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_265 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 37509735 - 37509969
Alignment:
| Q |
6 |
gaacaatatccaactgcttcttcatcccaaaaaactattgaattcagctctataaatcctat-----------acatcacatttgagtttacaaacaaaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
37509735 |
gaacaatatccaactgcttcttcatcccaaaaaactactgaattcagctctataaatcctatctatattaaaaacatcacatttgagttcacaaacaaaa |
37509834 |
T |
|
| Q |
95 |
gaacttgccggatgccctttcacaaactcctttgctgtgaaattttttatgcaccttaactgcaaatgacgtccttcacattcttcatgatttgaacata |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37509835 |
gaacttgccggatgccctttcacaaactcctttgctgtgaaattttttatgcaccttaactgcaaatgacgtccttcacattcttcatgatttgaacata |
37509934 |
T |
|
| Q |
195 |
tactgttgttcataaaactatgttgcacttcctga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37509935 |
tactgttgttcataaaactatgttgcacttcctga |
37509969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University