View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_286 (Length: 223)
Name: NF6875A_low_286
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_286 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33441763 - 33441985
Alignment:
| Q |
1 |
aacatcacacatgatcgattaacatccaatcttaaacagctatcaatctctgttaaatatttggaacaacttctttggcagcagggatcgacgggggaca |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| || |
|
|
| T |
33441763 |
aacatcacacatgatcggttaacatccaatcttaaacagctatcaatctctgttaaatatttggaaaagcttctttggcagcagggatcgacggggaacg |
33441862 |
T |
|
| Q |
101 |
ccactagcaggccatggtgaactcgaaggtggtgcttcaggtgtcgccaggtcaagtgatggtgatggagaaggtgaaggtactggagaccaaccatctt |
200 |
Q |
| |
|
| ||||||||||||||||| | ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33441863 |
ctactagcaggccatggtgcattcgaaggcggtgcttcaggtgtcaccaggtcaagtgatggtgatggagaaggtgaaggtactggagaccaaccatctt |
33441962 |
T |
|
| Q |
201 |
gttttggctgcacagttatgaaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33441963 |
gttttggctgcacagttatgaaa |
33441985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33451983 - 33452205
Alignment:
| Q |
1 |
aacatcacacatgatcgattaacatccaatcttaaacagctatcaatctctgttaaatatttggaacaacttctttggcagcagggatcgacgggggaca |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| || |
|
|
| T |
33451983 |
aacatcacacatgatcggttaacatccaatcttaaacagctatcaatctctgttaaatatttggaaaagcttctttggcagcagggatcgacggggaacg |
33452082 |
T |
|
| Q |
101 |
ccactagcaggccatggtgaactcgaaggtggtgcttcaggtgtcgccaggtcaagtgatggtgatggagaaggtgaaggtactggagaccaaccatctt |
200 |
Q |
| |
|
| ||||||||||||||||| | ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33452083 |
ctactagcaggccatggtgcattcgaaggcggtgcttcaggtgtcaccaggtcaagtgatggtgatggagaaggtgaaggtactggagaccaaccatctt |
33452182 |
T |
|
| Q |
201 |
gttttggctgcacagttatgaaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33452183 |
gttttggctgcacagttatgaaa |
33452205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University