View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_297 (Length: 215)
Name: NF6875A_low_297
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_297 |
 |  |
|
| [»] chr3 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 22 - 215
Target Start/End: Complemental strand, 6939051 - 6938856
Alignment:
| Q |
22 |
gtaacatagaaccattctacaaggcatcactctaatttatgcagtaggaatgatgagacagcagactttgatggaaacggacagctgaatgaaggaaacc |
121 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6939051 |
gtaacacagaaccattctggaaggcatcactctaatttatgcagtaggaatgatgagacagcagactttgatggaaacggacagctgaatgaaggaaacc |
6938952 |
T |
 |
| Q |
122 |
gagtatcaggac--agtttgtttcagtcagagaatatcattgtcgagaggtgtgcattttgtgatgtcaggactcaggcagctacttcaacttctt |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6938951 |
gagtatcaggacaaagtttgtttcagtcagagaatatcattgtcgagaggtgtgcattttgtgatgtcaggactcaggcagctacttcaacttctt |
6938856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 22 - 209
Target Start/End: Original strand, 6549841 - 6550030
Alignment:
| Q |
22 |
gtaacatagaaccattctacaaggcatcactctaatttatgcagtaggaatgatgagacagcagactttgatggaaacggacagctgaatgaaggaaacc |
121 |
Q |
| |
|
|||||| ||||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6549841 |
gtaacacagaaccattctgcaaggcactactccaatttatgcattaggaatgatgagacagcagactttgatggaaacggacagctgaatgaaggaaacc |
6549940 |
T |
 |
| Q |
122 |
gagtatcaggac--agtttgtttcagtcagagaatatcattgtcgagaggtgtgcattttgtgatgtcaggactcaggcagctacttcaa |
209 |
Q |
| |
|
||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
6549941 |
gagcagcaggacaaagtttgtttcagtcagagaatatcattgtcgagaggtgtgcattttgtgatgtcaggactcaggcatccacttcaa |
6550030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 6796619 - 6796700
Alignment:
| Q |
22 |
gtaacatagaaccattctacaaggcatcactctaatttatgcagtaggaatgatgagacagcagactttgatggaaacggac |
103 |
Q |
| |
|
|||||| ||||||||||| |||||| |||| |||||||||| |||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
6796619 |
gtaacacagaaccattctccaaggcgctactccaatttatgcattaggaatgatgatacagcagactttgacggaaatggac |
6796700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 6764052 - 6763998
Alignment:
| Q |
29 |
agaaccattctacaaggcatcactctaatttatgcagtaggaatgatgagacagc |
83 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||| ||||||||||||| |||| |
|
|
| T |
6764052 |
agaaccattctacaagacactactccaatttatgcattaggaatgatgagtcagc |
6763998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 142 - 187
Target Start/End: Original strand, 6796775 - 6796820
Alignment:
| Q |
142 |
tcagtcagagaatatcattgtcgagaggtgtgcattttgtgatgtc |
187 |
Q |
| |
|
|||| ||||||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
6796775 |
tcagacagagaaaatcattgtggagaggcgtgcattttgtgatgtc |
6796820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University