View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_298 (Length: 215)
Name: NF6875A_low_298
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_298 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 22 - 128
Target Start/End: Complemental strand, 47094433 - 47094327
Alignment:
| Q |
22 |
taacaactatttcaaatgaacaacaaacattctcatcactcatctcacctctattcaacaatggcacccaaaacaaaccactcaaacacgtccatcatct |
121 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
47094433 |
taacaactatttcaaatgaacaaaaaacattctcatcactcatctcacctctattcaacaatggcacccaaaacaaaccactcaaacactttcatcatct |
47094334 |
T |
|
| Q |
122 |
tcttact |
128 |
Q |
| |
|
||||||| |
|
|
| T |
47094333 |
tcttact |
47094327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University