View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_300 (Length: 215)
Name: NF6875A_low_300
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_300 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 7839787 - 7839613
Alignment:
| Q |
17 |
gagatgaaagggaaaactgtttttgttatattttataaggtggaagcttctgatgttagacatcaaagaaagagctatgaaattgcaatgattcaacatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7839787 |
gagatgaaagggaaaactgtttttgttatattttataaggtggaagcttctgatgttagacatcagagaaagagctatgaaattgcaatgattcaacatg |
7839688 |
T |
|
| Q |
117 |
aaaagagatttggaaaggaatcggagaaggtgaagaaatggaggtctgctttggaaagagtttctgctcttagtg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
7839687 |
aaaagagatttggaaaggaatcggagaaggtgaagaaatggaggtctgctttgaaaagagtttgtgctcttagtg |
7839613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 38 - 150
Target Start/End: Complemental strand, 7763098 - 7762985
Alignment:
| Q |
38 |
tttgttatattttataaggtggaagcttctgatgttagaca-tcaaagaaagagctatgaaattgcaatgattcaacatgaaaagagatttggaaaggaa |
136 |
Q |
| |
|
|||||||| ||||||||| | ||| |||| |||||||| | ||| || || || ||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7763098 |
tttgttattttttataagatagaaccttcagatgttaggtagtcagaggaatagttatgaaattgcaatgatgaaacatgaaaatagatttggaaaggaa |
7762999 |
T |
|
| Q |
137 |
tcggagaaggtgaa |
150 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7762998 |
tcggagaaggtgaa |
7762985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 150
Target Start/End: Complemental strand, 7755571 - 7755532
Alignment:
| Q |
111 |
aacatgaaaagagatttggaaaggaatcggagaaggtgaa |
150 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7755571 |
aacatgaaaagagatttggaagggaatcggagaaggtgaa |
7755532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University