View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_313 (Length: 208)
Name: NF6875A_low_313
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_313 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 23 - 208
Target Start/End: Original strand, 7012231 - 7012416
Alignment:
| Q |
23 |
tacattattctgagttgaagtatttactttcattatatctaccttcacaatgtggtgatcagaagttcctttagaagaaattactgagtatgaccctgga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012231 |
tacattattctgagttgaagtatttactttcattatatctaccttcacaatgtggtgatcagaagttcctttagaagaaattactgagtatgaccctgga |
7012330 |
T |
|
| Q |
123 |
acaaatttgtatggtgattttgatgaacccaaaatataatccacccttgttccatacttgcatgtcccctgcacatctatattcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012331 |
acaaatttgtatggtgattttgatgaacccaaaatataatccacccttgttccatacttgcatgtcccctgcacatctatattcaa |
7012416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University