View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_319 (Length: 202)
Name: NF6875A_low_319
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_319 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 26 - 181
Target Start/End: Original strand, 26437890 - 26438045
Alignment:
| Q |
26 |
agatccaaaactttgaggttttcgcatttggcaatagcattaggcaatcgccccttcaattgatttccattgaaatttatggtctctaaaactctcatct |
125 |
Q |
| |
|
||||||||||||| || |||| |||||||||||| ||| ||| ||| | ||| |||||||||||||||| ||| | || ||||||||||||||||||| |
|
|
| T |
26437890 |
agatccaaaacttccagttttttccatttggcaataacatgaggtaatggtcccgtcaattgatttccattcaaaatcatagtctctaaaactctcatct |
26437989 |
T |
 |
| Q |
126 |
caaaatagattttgggtatgattccaacaaggttgttcttttgtagatctaaaact |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26437990 |
caaaatagattttgggtatgattccaacaaggttgttcttttgtagatctaaaact |
26438045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 26 - 181
Target Start/End: Original strand, 26451259 - 26451414
Alignment:
| Q |
26 |
agatccaaaactttgaggttttcgcatttggcaatagcattaggcaatcgccccttcaattgatttccattgaaatttatggtctctaaaactctcatct |
125 |
Q |
| |
|
||||||||||||| || |||| |||||||||||| ||| ||| ||| | ||| |||||||||||||||| ||| | || ||||||||||||||||||| |
|
|
| T |
26451259 |
agatccaaaacttccagttttttccatttggcaataacatgaggtaatggtcccgtcaattgatttccattcaaaatcatagtctctaaaactctcatct |
26451358 |
T |
 |
| Q |
126 |
caaaatagattttgggtatgattccaacaaggttgttcttttgtagatctaaaact |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26451359 |
caaaatagattttgggtatgattccaacaaggttgttcttttgtagatctaaaact |
26451414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University