View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_63 (Length: 343)
Name: NF6875A_low_63
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 3 - 337
Target Start/End: Complemental strand, 36170710 - 36170376
Alignment:
| Q |
3 |
tgtcgaacaaaatatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattg |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170710 |
tgtcgaacataatatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattg |
36170611 |
T |
 |
| Q |
103 |
ttatttcctttgtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccgtttgcctaaccaactc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36170610 |
ttatttcctttgtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccatttgcctaaccaactc |
36170511 |
T |
 |
| Q |
203 |
atctccaaaggcaatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170510 |
atctccaaaggcaatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcc |
36170411 |
T |
 |
| Q |
303 |
tcaaccataaatctcttaacttcctcaacaccaac |
337 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
36170410 |
tcaaccatgaatctcttaacttcctcaacaccaac |
36170376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 3 - 65
Target Start/End: Original strand, 1286332 - 1286394
Alignment:
| Q |
3 |
tgtcgaacaaaatatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286332 |
tgtcgaacataatatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
1286394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University