View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6875A_low_84 (Length: 323)
Name: NF6875A_low_84
Description: NF6875A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6875A_low_84 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 222 - 316
Target Start/End: Original strand, 28963075 - 28963169
Alignment:
| Q |
222 |
agaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatctttcttgtcactaattcat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||| | | |||||||||| |
|
|
| T |
28963075 |
agaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaggaatgaattgctgaccttggatttttatctttcctttaactaattcat |
28963169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 22 - 184
Target Start/End: Original strand, 4745230 - 4745392
Alignment:
| Q |
22 |
gtttcgtcttgtaacttggtaattgccaaatcaatgtttggagcttacatcccatattttaacctttgtaacttgctgattttgaaactcaaacgattgc |
121 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| ||||||| || |||||||||| ||||||||| ||| || || ||||| | ||| ||| ||||| |
|
|
| T |
4745230 |
gtttcggcttgtaacttggtaatcgccaaatcaaagtttggacctcacatcccatactttaaccttcgtagctgactaattttcatactttaacaattgc |
4745329 |
T |
|
| Q |
122 |
acaatttctgtgatgggcagagagataagtgagtagtaaatgaagtttagaacaattttaaag |
184 |
Q |
| |
|
||||||| | |||| ||||||||||| |||| ||||||| |||||||| |||||| ||||||| |
|
|
| T |
4745330 |
acaatttatatgattggcagagagatgagtgggtagtaagtgaagtttggaacaactttaaag |
4745392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 223 - 301
Target Start/End: Complemental strand, 3442843 - 3442765
Alignment:
| Q |
223 |
gaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatctttc |
301 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||||||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
3442843 |
gaaaaatgctttattgcacgagaacaaaccatgcacgacaacttacgaatgaattgctgcccttggatttttatctttc |
3442765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 228 - 301
Target Start/End: Complemental strand, 24115931 - 24115857
Alignment:
| Q |
228 |
atgctttatggtacgagagcaaacc-atgcacgacaacttaagaatgaattgctgctcttgaatttttatctttc |
301 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |||||||||||| | |||| ||||||||||||| |
|
|
| T |
24115931 |
atgctttatggtacgagaacaaacccatgcacgacaacttgcgaatgaattgcttcccttggatttttatctttc |
24115857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 223 - 300
Target Start/End: Complemental strand, 26683875 - 26683799
Alignment:
| Q |
223 |
gaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatcttt |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||| ||| || ||||||||||||||||| |
|
|
| T |
26683875 |
gaaaaatgctttatggtacaagagcaaaccatgcacgacaacttgcaaatgaa-tgccgcccttgaatttttatcttt |
26683799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University