View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_high_52 (Length: 243)
Name: NF6876A_high_52
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 23 - 164
Target Start/End: Original strand, 6323237 - 6323375
Alignment:
| Q |
23 |
ttcctcgcttgtgtttgtggcggcgatttgtctcagtgttcctgtgatgatacaaacacagtgtcatcttaatttcaaatcatcaatctttgtttttgat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6323237 |
ttcctcgcttgtgtttgtggcggcgatttgtctcagtgttcctgtgatgatgcaaacacagtgtcatcttaatttcaaatcatcaatctttgtttttgat |
6323336 |
T |
 |
| Q |
123 |
cccgaaggaatattcacttggtcttccttcgttgcaacacca |
164 |
Q |
| |
|
||| ||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
6323337 |
cccaaag---cattcacttggtcttccttcgtcgcaacacca |
6323375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University