View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_high_56 (Length: 224)
Name: NF6876A_high_56
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 37918222 - 37918193
Alignment:
| Q |
175 |
ctccaaaaatgcatcatctaaactcacacc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37918222 |
ctccaaaaatgcatcatctaaactcacacc |
37918193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University