View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_122 (Length: 302)
Name: NF6876A_low_122
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_122 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 26158484 - 26158183
Alignment:
| Q |
1 |
gaaccaacctgctctagctnnnnnnncacttcaattacccaaccagacgatggtgcagaatgtatgtggaatatctgctcttggtcctcctgcaatggag |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26158484 |
gaaccaacctgctctagctaaaaaaacacttcaattacccaaccagacgatggtgcagaatgtatgtggaatatctgctcttggtcctcctaatatggag |
26158385 |
T |
|
| Q |
101 |
taataaccgagaaactgattattatcctcatcttggctggtagaaatcacctcggtaaaccaatatgagcgtgctgaaaaccgaaaaccactcccaggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26158384 |
taataaccgagaaactgattattatcctcatcttggctggtagaaatcatctcggtaaaccaatatgggcgtgctgaaaaccgaaaaccactcccaggag |
26158285 |
T |
|
| Q |
201 |
ggaaagatgggctataactctgtacccagagatacctcaaagattttaaattatatgcagcaacacctagcacaacctcactgaaaaatttgcaccctct |
300 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26158284 |
ggaacgatgggctataactctgtacccagagatacctcaaagattttaaattatatgcagctacacctagcacaacctcactgaaaaatttgcaccctct |
26158185 |
T |
|
| Q |
301 |
ga |
302 |
Q |
| |
|
|| |
|
|
| T |
26158184 |
ga |
26158183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University