View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_123 (Length: 302)
Name: NF6876A_low_123
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_123 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 5 - 276
Target Start/End: Complemental strand, 19438223 - 19437952
Alignment:
| Q |
5 |
tataacaagagctaagaaaaagtcaaatatgaagtgtggaactataacccattagagatttcaatttcactatcatcagcatctgctgctaaggctgcaa |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19438223 |
tataacaaaagctaagaaaaagtcaaatatgaagtgtggaactctaacccattagagatttcaatttcactatcatcagcatctgctgctaaggctgtaa |
19438124 |
T |
|
| Q |
105 |
caacaggaaaccttctttgatttactccaaaggccctcttcaccaatggagagaacaccaagcttgaatttatagactcatgttgaagtgttctagactt |
204 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19438123 |
caactggaaaccttctttgatttactccaaaggccttcttcaccaatggagagaacaccaagcttgaatttatagactcatgttgaagtgttctagactt |
19438024 |
T |
|
| Q |
205 |
caacaatccataactagttgaacatgaaactctttttggtaacagaaaaactgaagatatttgaggtctttg |
276 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19438023 |
caacaatccataactagttgaacttgaaactctttttggtaacagaaaaactgaagatatttgaggtctttg |
19437952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University