View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_136 (Length: 296)
Name: NF6876A_low_136
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_136 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 36166142 - 36166418
Alignment:
| Q |
18 |
acatcaatctaatattccctttcaaaaggtacaagaaagccttgatgaaagcaaaattgagaccatcgggtcccatactcttattaccctcaattttcaa |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36166142 |
acatcaatctaatattctctttcaaaaggtacaagaaagccttgatgaaagcaaaattgagaccatcgggtcccatact-ttattaccctcaattttcaa |
36166240 |
T |
 |
| Q |
118 |
aacgactgcttctatttccaaaagtgaaaaaggcgccaccaacaaagcattttccacctcctaaagccttgcaaagtttaccccatccaactttggccga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36166241 |
aacgactgcttctatttccaaaagtgaaaaaggtgccaccaacaaagtatttcccacctcctcaagccttgcaaagtttaccccatccaactttggtcga |
36166340 |
T |
 |
| Q |
218 |
tcccaagtagatgagacatggctcctaaagtaattcaccaccgtctccctcacttctaatgttttttgaatccaaacct |
296 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| | ||||||| ||||||||||||||||||||||||| |
|
|
| T |
36166341 |
tcccaagtagatgagacatggctcctaaaataattcaccaccg-ccccctcacctctaatgttttttgaatccaaacct |
36166418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University