View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_140 (Length: 295)
Name: NF6876A_low_140
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_140 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 47599497 - 47599234
Alignment:
| Q |
1 |
tcaacaaccaaatcagacctaacaatccctctaaccatcatgtgcacaccactctcccaacacggcactgacctacctcttctcccttacgatcctctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599497 |
tcaacaaccaaatcagacctaacaatccctctaaccatcatgtgcacaccactctcccaacacggcactgacctacctcttctcccttacgatcctctcc |
47599398 |
T |
|
| Q |
101 |
tctgcactcgatgcggcgccgttttaaacccttacgctcgtctcgattatcaatcacgtatctggcactgtcccttttgttctcaacgaaacccttttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599397 |
tctgcactcgatgcggcgccgttttaaacccttacgctcgtctcgattatcaatcacgtatctggcactgtcccttttgttctcaacgaaacccttttcc |
47599298 |
T |
|
| Q |
201 |
tcgctccatcgccgacgctaatcttcccgctgaactctttcctacttacaccactgttgaatac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599297 |
tcgctccatcgccgacgctaatcttcccgctgaactctttcctacttacaccactgttgaatac |
47599234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University