View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6876A_low_197 (Length: 258)
Name: NF6876A_low_197
Description: NF6876A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6876A_low_197 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 145 - 252
Target Start/End: Original strand, 276355 - 276463
Alignment:
| Q |
145 |
gagtaaaactgttctctttgccgttaaaaataaaataaaa-ttgtttaactaaaatggattgcttttctatttgtataaaataattgttactaatattat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
276355 |
gagtaaaactgttctctttgccgttaaaaataaaataaaaattgtttaactaaaatggattgatttgatatttgtataaaataattgttactaatattat |
276454 |
T |
 |
| Q |
244 |
gcttgtatt |
252 |
Q |
| |
|
||||||||| |
|
|
| T |
276455 |
gcttgtatt |
276463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 12 - 79
Target Start/End: Original strand, 276277 - 276344
Alignment:
| Q |
12 |
atgaatgcatggttcacattaccactagattgtatggtagtaaggaattgatatgtaatggttttcaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
276277 |
atgaatgcatggttcacattaccactagattgtatggtagtaaggaattgatatgtaatggttttcaa |
276344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University